Main Title Image

Last updated

August 10, 2003
 
IntroductionResearch PagesPeople involvedPhoto galleriesPublicationsOther sample sitesEducationLinks to other micobial observatories
Polymerase Chain Reaction (PCR) [back]  

Polymerase Chain Reaction (with Pfu)

Polymerase Chain Reaction (PCR) was used for amplification of 16S rRNA gene from the community DNA from the environments and pure cultures. Proofreading polymerase Pfu is used in order to obtain high fidelity product and also to facilitates the cloning into the TOPO cloning vector directly.

Example of primers used for PCR are listed below:

Primers used for amplification and sequencing of the 16S rRNA gene

27F 5' AGAGTTTGATCCTGGCTCAG 3'
533F 5' GTGCCAGCMGCCGCGGTAA 3'
981R 5´GGG TTG CGC TCG TTG CGG G 3´
1492R 5´GGTTACC TTG TTA CGA CTT3´
T3 5' AATTAACCCTCACTAAAGGGA 3'
T7 5' TAATACGACTCACTATAGGG 3'

Setting up PCR Reaction:

10x Pfu Buffer 5.0 ml
DMSO 3.0 ml
Primer 1 1.5 ml
Primer 2 1.5 ml
dNTP 3.0 ml
DNA 1.0-5.0 ml
dH20 add to 49.0 ml
HOT START:  
Pfu Polymerase 1.0 ml
Total 50 ml
   

Set up thermocyler program:


Hot Start
Denaturation 94°C 30 sec
Annealing 55°C 30 sec
Extension 72°C 90 sec (1 min/kb)
25-30 cycles

After cycling, incubate the reaction at 72°C for another 7 min. Cool the reactions to 4°C, ready for further experiments.

     

  This website is maintained by Alam's Lab, Department of Microbiology, University of Hawai'i. All rights reserved.

Link to National Science Foundation website Link to University of Hawaii website Link to Department of Microbiology website Link to Maqsudul Alam lab website Back to main page