|
||||||||||||||||||||||
|
Polymerase Chain Reaction (PCR) | [back] | ||||||||||||||||||||
Polymerase Chain Reaction (with Pfu) Polymerase Chain Reaction (PCR) was used for amplification of 16S rRNA gene from the community DNA from the environments and pure cultures. Proofreading polymerase Pfu is used in order to obtain high fidelity product and also to facilitates the cloning into the TOPO cloning vector directly. Example of primers used for PCR are listed below: Primers used for amplification and sequencing
of the 16S rRNA gene 27F 5' AGAGTTTGATCCTGGCTCAG 3' Setting up PCR Reaction: |
||||||||||||||||||||||
|
||||||||||||||||||||||
| Set up thermocyler program:
|
||||||||||||||||||||||
| This website is maintained by Alam's Lab, Department of Microbiology, University of Hawai'i. All rights reserved. | ||||||||||||||||||||||